E- ISSN: 2320 - 3528
P- ISSN: 2347 - 2286

All submissions of the EM system will be redirected to Online Manuscript Submission System. Authors are requested to submit articles directly to Online Manuscript Submission System of respective journal.

Characterization and Pathogenicity of Two Bacteria Isolated from A Local Chinese Hospital

Liang Chen1, Shuang Lu1, Weiping Cao2, Peng Lü1, Chunxia Zhang1, Hongzheng Gu2* and Keping Chen1*

1Institute of Life Sciences, Jiangsu University, Zhenjiang, 212013, China

2The Fourth People’s Hospital of Zhenjiang, 212013, China

*Corresponding Authors:
Hongzheng Gu
The Fourth People’s Hospital of Zhenjiang
212013 Jiangsu, China
Tel: +86-551-84425604
E-mail: jszjghz@163.com
 
Keping Chen
Institute of Life Sciences, Jiangsu University
Zhenjiang, 212013 Jiangsu, China
Tel and Fax: +86-551-88791923
E-mail: kpchen@ujs.edu.cn, galzi@unistra.fr

Received date: 07/08/2017; Accepted date: 28/08/2017; Published date: 26/09/2017

Visit for more related articles at Research & Reviews: Journal of Microbiology and Biotechnology

Abstract

Contamination and antimicrobial resistance levels in hospitals raise increasing concern not only in the fields of medicine and healthcare, but also in environment protection. In this experiment, two strains of bacteria were isolated from a Chinese local hospital, and their physiological and biochemical characteristics and drug resistance were investigated. We identified these two strains of bacteria as Bacillus subtilis and Bacillus cerecus using 16S rRNA sequence and phylogenetic analysis as well as proteomic tandem mass spectrometry. The pathogenicity of the two strains was studied using silkworms, and we found that B. cereus had a strong pathogenicity, with half of the lethal dose being 4 × 104 cfu/ml. Moreover, the supernatant of B. cereus also had a strong lethality to silkworm, possibly due to the presence of flagella protein and metal proteases. These two proteins may play an important role in the pathogenicity of B. cereus.

Keywords

Hospital, Bacillus subtilis, Bacillus cerecus, characterization, pathogenicity, MDR bacterial, silkworm

Introduction

In recent years, the problem of multidrug-resistant (MDR) bacteria has gradually become the focus of healthcare facilities [1-3]. The MDR bacteria are not only a healthcare problem but also an environmental problem [4-6]. In particular, the emergence and rapid spread of and pan-drug resistance bacteria can make clinical treatment difficult [7-9]. China is a developing country, and hospitals in large cities have made remarkable improvements in their environments, including the disinfection, sterilization, supervision and monitoring [10]. Many hospitals also investigate and research environmental and pathogenic microorganisms. A study of device-associated, healthcare-associated infection rates and microorganism profiles in a hospital in Shanghai, China, showed that the overall infection rate was 5.3%, and the number of infections per 1000 intensive care unit days reached 6.4% [11]. Recent investigation of 94 medical hospitals of Shandong province in China, show the qualified rate was 36.6%, 55.7% and 68.1% respectively, from year 2013 to 2015 [12]. The bacterial sedimentation assay shown that the qualified rate of operation room was 61.1%, 79.5% and 82.5% respectively. There is an upward trend in cleaning effect qualified rate of medical equipment, but the figures are still worthy of vigilance.

Bacillus cereus, a Gram-positive bacteria species capable of forming spores, is a conditional pathogenic bacteria that can produce a variety of toxins [13]. It can cause clinical endophthalmitis sepsis, most commonly seen as food poisoning [14]. B. subtilis is a Gram-positive rod-shaped bacterium that can produce endogenous spores and is widely distributed among a variety of different environments. B. subtilis is usually treated as non-pathogenic bacteria and is widely used in fermentation engineering to produce a variety of enzymes, antibiotics, and so on.

Mass spectrometry is widely used in the identification of bacteria [15]. Over the years, it has been demonstrated that bacteria can be identified by specific proteins [16]. In the development of protein libraries, the bacterial protein two-dimensional electrophoresis tandem mass spectrometry method effectively identifies bacterial species. Moreover, this method can distinguish between species that are highly similar. This method identifies species by identifying the source of the corresponding protein spot on a two-dimensional map.

The pathogenic environment in hospital is likely to endanger the health of the patient; therefore, the assessment of the pathogenicity of environmental microbes is important. However, it is relatively expensive to assess bacterial pathogenicity using animal models. Kaito et al. reported a silkworm infection model in which silkworms were killed by injection with microorganisms that are virulent in humans, such as Staphylococcus aureus, Pseudomonas aeruginosa, Vibrio cholerae, and pathogenic strains of Escherichia coli, whereas the silkworms were not killed by nonpathogenic strains of E. coli. This silkworm model has been used to identify S. aureus virulence genes [17]. It has also been reported that silkworms are useful for evaluating the pathogenicity of a Bacillus soil bacterium, as well as for purifying an exotoxin secreted from this bacterium by monitoring its toxicity [18]. Furthermore, bacteria isolated from fish and shellfish were tested for pathogenicity in silkworms. The results showed that there were 10 strains having a strong pathogenicity in silkworms [19]. Exotoxins secreted by pathogenic microorganisms can also be identified by silkworms [20]. Similarly, we can also view some current silkworm infection models [21-23].

In this study, two strains were isolated and purified from a hospital in Zhenjiang City, Jiangsu Province, China. These two strains were assessed in terms of their physiological and biochemical characteristics by 16S rRNA sequencing using two-dimensional electrophoresis tandem mass spectrometry. Then, the pathogenicity of the two strains was evaluated by examining silkworm infection patterns. Additionally, the pathogenicity of the supernatant of B. cereus was evaluated. Finally, we identified two kinds of secreted proteins that may be related to the pathogenicity of B. cereus.

Materials and Methods

Bacterial Strains

For the experiments, two wild-type strains of Bacillus spp. were randomly collected, strain 41-1 isolated from an ophthalmology room and strain 65-5 isolated from an operating theater and gastroscopy room of the Fourth People’s Hospital of Zhenjiang, Jiangsu, China. The samples were suspended in sterilized water, and the supernatants were spread onto nutrient agar plates. Colonies were isolated after overnight incubation.

Morphologic and Biochemical Characterization of Strains 41-1 and 65-5

The colony characteristics of 41-1 and 65-5 were observed after growing on a nutrient agar plate at 37°C for 36 h, and cellular morphology was determined using light microscopy and Gram staining [24]. Physiological and biochemical analyses were performed by referring to Bergey’s Manual [25] and the Manual for the Microbiology Experiment [26]. Antibiotic sensitivity tests were performed as before [27].

PCR Amplification of 16S rRNA Sequences

The 16S rRNA region was amplified by colony PCR (95°C for 5 min, followed by 30 cycles of 95°C for 45 s, 55°C for 45 s, and 72°C for 100 s, followed by 10 min at 72°C) using the primer pair 27F (AGAGTTTGATCATGGCTCAG) and 1492R (TACGGTTACCTTGTTACGACTT) [28], and was subsequently sequenced. The sequence was deposited in GenBank. The sequence was analyzed online (http://rdp.come.msu.edu). Homology comparisons of the nearly-complete 16S rRNA gene sequences of 41-1 and 65-5 were performed using the BLAST database on the NCBI website (http://www.ncbi.nlm.nih.gov/Blast.cgi). Sequence alignment was carried out using CLUSTAL X software. A phylogenetic tree was built using the MEGA 5.0 software package [29,30] and was constructed using the neighbor-joining method.

Evaluation of the Toxicity of the Bacterial Strains using Silkworms

Silkworm infection experiments were performed in accordance with previously established methods [17]. Silkworm strain 306 was raised from fertilized eggs to fifth-instar larvae in our laboratory. The newly exuviated fifth-instar larvae were fed with antibiotic-free mulberry leaves for 1 d. Then, a total of 5 μl of an overnight culture of the hospital bacteria strains was injected into the silkworm hemolymph through the intersegment membrane using a sterile micro syringe (Shanghai Micro plate, Shanghai, China). Pressure was immediately applied for 10 s at the injection site using alcohol wipes to stop any bleeding. Control larvae were injected with saline (0.6% NaCl). The larvae were maintained at room temperature. Each experimental group contained 10 silkworm larvae, and the number of living silkworm larvae was counted every 12 h. All experiments were independently performed at least three times.

Sample Preparation

After 20 h incubation in Luria Bertani (LB), B. subtilis and B. cereus were collected and washed several times, after which the bacteria were sonicated, and the total cell extract (supernatant) was mixed with aliquots of 20% tetrachloroacetic acid (TCA) acetone at -20ºC for 12 h to precipitate the protein. The protein was isolated by centrifugation at 13,000 g, 4°C for 20 min, was washed twice with acetone containing 20 Mm Dithiothreitol (DTT) and 1 mM phenylmethylsulfonyl fluoride (PMSF), and dried and stored at −80°C until use. The protein content of the pellet was determined by the Bradford method [31].

Immediately after harvesting, the culture supernatants were centrifuged at 8000 rpm for 20 min at 4°C. The supernatant of the centrifugation was rapidly filtered through a membrane (pore size=0.2 um; Nalgene Sterilization Unit, Nalge Company). The protein was then precipitated using the deoxycholate-tetrachloroacetic acid method [32]. The pellet was washed twice with ethanol:ether (1:1) and was dried and stored at −80°C until use. The protein content of the pellet was determined by the Bradford method [31].

Two-Dimensional Electrophoresis

Two-dimensional electrophoresis (2-DE) was performed with a 17-cm (linear, pH 4-7) immobilized pH gradient (IPG) gel strip (Bio-Rad, USA), as described by Liang et al. [33]. Total protein (3 mg) was loaded onto the IPG strip using active rehydration (50 V for 13 h), and isoelectric focusing (IEF) was performed at 17°C with a voltage gradient of 250 V for 30 min, 1000 V for 1 h, 10,000 V for 5 h, and then continued for a total of 60 kVh. The IPG gel strip was equilibrated for 15 min with equilibration buffer (6 M urea, 0.375 M Tris-HCI, 20% (v/v) glycerol, 2% (w/v) SDS, and 2% [(w/v) DTT), and then was equilibrated for another 15 min with the same equilibration buffer without DTT, containing 2.5% (w/v) iodoacetamide. The equilibrated strip was sealed on the top of a 12% SDS-PAGE gel for electrophoresis. The gel was visualized with 0.1% Coomassie brilliant blue R-250 and was scanned with a high precision scanner (Scan Maker 9700XL, Microtek) at a resolution of 300 dpi. Spot analysis was performed using PDQuest (version 8.0.1, Bio-Rad). Triplicate experiments were carried out for each sample.

In-gel Digestion and Mass Spectrometry Analysis

In-gel digestion was performed as previously reported. The protein spots were excised from the stained gels, washed twice in milli-Q water, destained by sonication in 25 mM ammonium bicarbonate and 25% acetonitrile, dehydrated with acetonitrile, and dried in a vacuum. The dried proteins spots were treated with 10 mM DTT for 1 h at 56°C, alkylated with 40 mM iodoacetamide for 45 min at room temperature, washed with 25 mM ammonium bicarbonate, dehydrated with acetonitrile, and incubated with 5 μL trypsin solution (20 μg/mL) at 37ºC overnight to completely digest the proteins.

Protein Identification

Mass spectrometry data were analyzed using MASCOT (Matrix Science, London, UK) and the NCBInr bacterial protein sequence database. The parameters were set as missed cleavage: 1, fixed modification: acetylation of carbamidomethyl (C), variable modification: Glu → pyro-Glu (N-term Q) or oxidation of methionine (M), mass tolerance: 0.3 Da, and mass value: MiH+. Proteins with a minimum ion score of 49 (P<0.05) were considered to be reliably identified.

Results

Physiological and Biochemical Characteristics

The 41-1 and the 65-5 colonies grown on LB medium can see (Figure 1). All colonies were positive for catalase, the deoxidization of nitrate, and the Voges-Proskauer reaction (Table 1). On the basis of these observations, we made a preliminary judgment that both the 65-5 and 41-1 strains belonged to the Bacillus genus. The results of the antibiotic analysis are shown in (Table 2). The antibiotic sensitivity of these two bacteria was clearly different. Bacillus sp. 65-5 was sensitive to Kan, Gen, Tet, and Chl.

Tested items 41-1 65-5 Tested items 41-1 65-5
Oxidase + + semi-solid agar + -
Deoxidization of nitrate + + Lysozyme patience + -
Glucose fermentatiom + + V-P test + +
D-mannitol - - Parasporal crystal - -
(+,Positive;-,negative)

Table 1: Physiological and biochemical characteristics of 41-1 and 65-5

Bacterial Kalamycin Gentamycin Tetracycline Chloromycetin
41-1 R (≥ 64 µg/ml) R (≥ 16 µg/ml) R (≥ 16 µg/ml) R ( ≥ 32 µg/ml)
65-5 S (≤ 16 µg/ml) S (≤ 4 µg/ml) S (≤ 4 µg/ml) S (≤ 8 µg/ml)

Table 2: Antimicrobial susceptibility and resistance pattern of 41-1 and 65-5

microbiology-biotechnology-morphologic

Figure 1: The morphologic characterization of 41-1 and 65-5.

16S rRNA Gene Sequence and Phylogenetic Analysis

The 16S rRNA gene sequence of strain 41-1 was 1,516 bp in length and that of strain 65-5 was 1,515 bp in length. The 16S rRNA sequences of the two strains were analyzed by BLAST, which showed that the two strains belonged to the Bacillus sp. This conclusion agrees with the result of physiological and biochemical analyses. The 16S rRNA gene sequences of 17 strains of Bacillus were selected and compared in a phylogenetic tree (Figure 2). It can be seen that the 41-1 strain had a high similarity to the generalized B. cereus sensu lato, while the 65-5 strain had a high similarity to B. subtilis. Thus, we concluded that the strain 41-1 is a generalized B. cereus sensu lato, and 65-5 strain is B. subtilis.

microbiology-biotechnology-sequences-accession

Figure 2: Phylogenetic tree of the 16S rRNA sequences of two bacterial. The tree was constructed by the neighbor-joining method.Numbers in parentheses represent the sequences accession numbers in GenBank. The number at each branch point represents the percentage of bootstrap values.

Pathogenicity Assessment of the Two Bacterial Strains to Silkworms

As shown in (Table 3), when the bacterial cells were injected, all the silkworms were killed by bacteria strain 41-1 within 12 h, and by bacteria strain 65-5 within 108 h. This indicates that the lethality of bacteria strain 41-1 is stronger than strain 65-5. Moreover, the supernatant of the 41-1 strain was also able to kill all the silkworms within 24 h. To calculate the half-lethal dose of the 41-1 strain, the number of living silkworms was counted, as listed in (Table 3). The death probability of silkworms treated with different doses of strain 41-1 was evaluated by the Bliss method, and the median lethal dose (LD50) was 4 × 104 cfu/ml (Table 4).

  Survival rate of silkworms after injection
Sample 0h 12 h 24 h 36 h 48 h 60 h 72 h 84 h 96 h 108 h ≥ 120 h
0.6% NaCl 100 100 100 100 100 100 100 100 100 100 100
65-5 100 100 60 60 60 40 20 20 20 0 0
41-1 100 0 0 0 0 0 0 0 0 0 0
LB 100 100 100 100 100 100 100 100 100 100 100
supernatant of the 41-1 strain 100 70 0 0 0 0 0 0 0 0 0
Fifth instar larvae of silkworms (n=10) were injected with overnight cultures of two bacteria strains isolated from the hospital, or with supernatant of the 41-1 strain. 0.6% NaCl and LB were used as a control. The percentages of surviving larvae post-infection are shown.

Table 3: Killing of silkworms by bacterial strains.

Injected bacterial cell number/cfu Survival rates of silkworms after injection/%
0 h 2 h 4 h 6 h 8 h 10 h 12 h
NaCl 100 100 100 100 100 100 100
1 × 102 100 100 80 80 60 40 0
1 × 103 100 100 70 70 50 30 0
1 × 104 100 90 70 60 50 20 0
1 × 105 100 90 60 50 20 0 0
1 × 106 100 70 50 30 10 0 0
1 × 107 100 60 40 20 0 0 0

Table 4: The lethal effect of bacteria 41-1 on silkworm

When the larvae of silkworms were injected with pathogenic bacteria, they looked normal during the first few hours and then their activity decreased and they gradually stopped eating. Then, part of their bodies started to swell. Finally, their bodies became soft, and their skin turned dark or released a black, watery discharge. This indicates that the larvae suffered from septicemia due to the bacterial infections, and resulted from melanization. The incidence of larvae is shown in (Figure 3).

microbiology-biotechnology-bacteria-isolated

Figure 3: Silkworms that were injected with bacteria isolated from the hospital. A: Silkworms 5 d post-injection with saline (0.6% NaCl). B: After bacterial infection with strain 41-1, the silkworms' bodies expanded, and the silkworms exhibited diarrhea and vomiting. C: After infection with Culture supernatant of strain 41-1.D: After bacterial infection with strain 65-5, the black color of the larvae killed by bacteria was cause by melanization.

Comparative Proteomics Analysis and Identification of the Two Strains of Bacillus sp.

As shown in (Figure 4), comparing the proteomic maps of the 65-5 strain and 41-1 strains, we found that the two proteomes had a different distribution of protein spots. To compare 65-5 with 41-1, we selected 12 protein spots from the protein map of the 65-5 strain and 11 protein spots from the protein map of the 41-1 strain. These protein spots were then identified by mass spectrometry. The results are shown in (Table 5). The proteins of the 65-5 strain were all identified as B. subtilis proteins, and all of the proteins of the 41-1 strain were identified as belonging to B. cereus. Thus, strain 65-5 and 41-1 isolated from the hospital were conclusively identified as B. subtilis and B. cereus, respectively. B. anthracis, B. thuringiensis, and B. cereus can be distinguished from each other by their overall 2-DE protein patterns.

microbiology-biotechnology-bacteria-strain

Figure 4: Comparison of 2-DE gel from bacteria strain 65-5 and bacteria strain 41-1.A:2-DE pattern of proteins from bacteria strain 65-5.B: 2-DE pattern of proteins from bacteria strain 41-1.

Spot no. Accession Protein name pIa MWb AAc No. peptide matchedd Seq Cov(%)e Score
Expressed in 65-5
A-1 P38021 Ornithine aminotransferase 5.07 44133 401 11 2% 47
[Bacillus subtilis subsp. subtilis str. 168]
A-2 CUB27349.1 Malate dehydrogenase 4.99 33632 312 39 13% 228
 [Bacillus subtilis]
A-3 924003915 Alkyl hydroperoxide reductase subunit C [Bacillus subtilis] 4.5 20713 187 14 7% 97
CUB32558
 
A-4 BAA12507.1 YqgD [Bacillus subtilis] 5.15 25332 226 49 21% 266
A-5 AFQ59382.1 Ribosome-associated sigma 54 modulation protein [Bacillus subtilis QB928] 5.36 22097 190 21 11% 74
A-6 WP_033881820 fructose-6-phosphate aldolase, partial [Bacillus subtilis] 5.73 22414 208 34 16% 145
A-7 WP_019714429 elongation factor Ts [Bacillus subtilis] 5.17 32462 293 15 5% 102
A-8 EHA32564.1 triosephosphate isomerase [Bacillus subtilis subsp. subtilis str. SC-8] 4.93 27418 256 29 11% 85
A-9 AID00070 heme peroxidase [Bacillus subtilis subsp. subtilis str. OH 131.1] 5.23 28970 249 12 4% 81
A-10 WP_025853878 ABC transporter ATP-binding protein[Bacillus subtilis group] 4.77 29144 261 14 5% 70
A-11 WP_015483183 pyruvate dehydrogenase E1 component subunit beta 4.79 35466 325 15 4% 74
[Bacillus subtilis]
A-12 WP_003221888 ATP synthase subunit alpha 5.22 54709 502 23 4% 155
[Bacillus subtilis]
Expressed in 41-1
B-1 SCC63043 Alanine dehydrogenase [Bacillus cereus] 5.22 40141 377 62 16% 346
B-2 EEL50644 Butyryl-CoA dehydrogenase [Bacillus cereus Rock3-44] 5.61 40659 371 27 7% 178
B-3 CUB10128 Pyruvate dehydrogenase E1 component subunit beta 4.76 35221 325 13 4% 108
 [Bacillus cereus]
B-4 EEL03554 Triosephosphate isomerase 1 5.01 27081 254 11 4% 75
[Bacillus cereus BDRD-ST196]
B-5 WP_000054174 Superoxide dismutase [Mn] 1 [Bacillus cereus] 5.34 24753 218 30 13% 152
B-6 WP_060488430 ribosome-recycling factor [Bacillus cereus] 6.45 20579 185 10 6% 74
B-7 ADK04225 nucleoside diphosphate kinase 5.26 18849 166 14 8% 116
[Bacillus cereus biovar anthracis str. CI]
B-8 EAL11933 fructose-1,6-bisphosphatase, class II 5.52 33346 315 39 12% 182
[Bacillus cereus G9241]
B-9 WP_000101972 Electron transfer flavoprotein subunit alpha [Bacillus cereus] 4.83 34475 326 23 7% 68
B-10 WP_000186155 pyridoxal 5'-phosphate synthase subunit PdxS [Bacillus cereus] 5.25 31789 295 23 7% 77
B-11 EJR09352 ATP-dependent Clp protease proteolytic subunit 2, partial [Bacillus cereus MSX-D12] 5.17 5907 50 14 28% 80
Supernatant of the 41-1 strain
C-1 WP_000048982 50S ribosomal protein L10 [Bacillus cereus group] 5.38 18044 166 27 16% 151
C-2 CUB10128 Pyruvate dehydrogenase E1 component subunit beta [Bacillus cereus] 4.76 35221 325 15 4% 91
C-3 WP_000101972 Electron transfer flavoprotein subunit alpha [Bacillus cereus] 4.83 34475 326 23 7% 97
C-4 SCC05347 Flagellin [Bacillus cereus] 5.13 47276 446 15 3% 95
C-5 AOM08110 Zinc metalloproteinase precursor 6.02 65340 591 16 3% 84
[Bacillus cereus]
C-6 CUB10849 1-pyrroline-5-carboxylate dehydrogenase 5.63 47811 437 14 3% 75
[Bacillus cereus]
C-7 EEL21676 Elongation factor Ts [Bacillus cereus Rock1-3] 5.25 32797 298 15 5% 91
C-8 EAL11933 fructose-1,6-bisphosphatase, class II [Bacillus cereus G9241] 5.52 33346 315 17 5% 142

Table 5. Proteins identified by MALDI-TOF MS

The A-11 protein spot of B. subtilis and the B-3 spot of B. cereus were both identified as pyruvate dehydrogenase E1 component subunit beta. The amino acid sequences of the two proteins had 89% similarity. The function of this protein in Bacillus sp is likely to be conserved.

Comparative Analysis of the Supernatant Proteins of B. subtilis and B. cereus

As shown in Figure 5, we selected 11 protein spots from the protein map of the 41-1 strain and 8 spots from the protein map of the supernatant of this strain. These protein spots were then identified by mass spectrometry. The results are shown in Table 5. Three B. cereus proteins were identical to three protein spots from the supernatant of overnight culture. Namely, B-3 was the same as C-2, B-8 was the same as C-8, and B-9 was the same as C-3. As mentioned above, both B-3 and C-2 were identified as pyruvate dehydrogenase E1 component subunit beta. Studies have shown that this protein acts as a fibronectin-binding protein in mycoplasma infection and promotes bacterial infection. Flagellin and metalloproteinases were also found in the supernatant of B. cereus. Studies have shown that they may play an important role in the pathogenicity of B. cereus.

microbiology-biotechnology-culture-supernatant

Figure 5: Comparison of 2-DE gel from bacteria strain 41-1 and supernatant of the 41-1 strain. A: 2-DE pattern of proteins from bacteria strain 41-1.B:2-DE gels of proteins from a culture supernatant of the 41-1 strain.

Discussion

In this study, two bacterial strains isolated from a hospital were studied in terms of their morphological, physiological, and biochemical characteristics, which is also a deep exploration of our previous work [27]. Based on these analyses, both bacteria strains 65-5 and 41-1 were preliminarily identified as Bacillus sp. The phylogenetic tree and 16S rRNA gene sequence analyses showed that bacteria 65-5 could be B. subtilis and bacteria 41-1 might be broadened B. cereus sensu lato. B. anthracis, B. thuringiensis, and B. cereus belong to the generalized B. cereus sensu lato group, and the similarity among them is very high. It is impossible to distinguish among them using the 16S rRNA method. Thus, one limitation of the 16S rRNA method is that only the bacterial genus can usually be identified [34]. However, bacteria with high similarity can then be distinguished from each other by two-dimensional electrophoretic tandem mass spectrometry [35,36], and we identified Bacillus sp. 65-5 and Bacillus sp. 41-1 based on 11 proteins belonging to B. subtilis and 10 proteins belonging to B. cereus. In the case of the pyruvate dehydrogenase E1 component subunit beta protein, the amino acid sequences had 89% similarity. Still, even in this case, the mass spectrometric results could distinguish the two strains as B. subtilis and B. cereus.

Both B. cereus (41-1) and the supernatant of B. cereus (41-1) showed strong pathogenicity to silkworms. The pathogenicity of B. cereus (41-1) was stronger than that of B. subtilis. Thus, B. cereus can infect silkworms and secrete a pathogenic protein that can kill silkworms to some extent. This study shows that B. cereus isolated from a hospital had a strong pathogenicity, and in the hospital environment it could easily lead to traumatic infections. Thus, the hospital should focus on protection against this bacterial strain. Proteome comparison analysis revealed that B. cereus (41-1) eluted flagellin and zinc protein precursors. Other studies have shown that flagellin contains a pathogen-associated molecular pattern, namely the flg22 epitope, which is recognized by the flagellin-sensitive 2 receptor kinase and functions as a pattern recognition receptor [37-39]. Among putative virulence factors are bacterial metalloproteases, with special regard to zinc containing proteases, which are known to act occasionally as toxins in many pathogenic bacteria [40,41]. Alternatively, they may play indirect roles in pathogenicity.

Conclusion

In summary, two bacterial strains in the hospital functional area were identified as B. subtilis and B. cereus, respectively, and their pathogenicity was described. We found that B. cereus and its supernatant were highly pathogenic in silkworm, while the lethal concentration was 4 × 104 cfu/ml. Silkworms is regarded not only as a good research model for human disease, but also for human pathogenic microbial infection. Silkworm is easy to feed and the growth cycle is short. In addition, the genetic background of silkworm is clear. Silkworm is used in exploring pathogenic microbial pathogenesis and antibiotic screening from the perspective of biosecurity. In recent years, MALDI-TOF-MS has been widely used as a new type of soft ionization mass spectrometry technology, which has been widely used in the rapid detection of pathogens and also provides reference for the identification of protein. In view of the above, MALDI-TOF-MS will be widely used in most clinical clinics, providing rapid and accurate clinical diagnosis. For the cleaning and health of hospital department, they should pay attention to the superimposed disinfection using a variety of drugs, to prevent the patient of bacterial infection after the trauma.

Acknowledgement

This study was funded by the Scientific Research Promotion Fund for the Talents of Jiangsu University (NO. 1291330009), Universities Natural Science Research Project of Jiangsu Province (15KJD180001), National Natural Science Foundation of China (NO. 31572467). This study was supported in part by the Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions.

References