E- ISSN: 2320 - 3528
P- ISSN: 2347 - 2286

All submissions of the EM system will be redirected to Online Manuscript Submission System. Authors are requested to submit articles directly to Online Manuscript Submission System of respective journal.

Heavy Metal Resistant CZC Genes Identification in Bacillus cereus, Enterobacter asburiae and Pseudomonas aeruginosa Isolated from BHEL Industry, Tamilnadu

J. Joonu1* and Horne Iona Averal2

1Department of Zoology, Bishop Heber College, Trichy, India

2Department of Zoology, Holy Cross College, Trichy, India

*Corresponding Author:
J. Joonu
Department of Zoology, Bishop Heber College, Trichy, India
E-mail: joonucharles@rediffmail.com

Received date: 23/09/2016; Accepted date: 01/11/2016; Published date: 28/11/2016

Visit for more related articles at Research & Reviews: Journal of Microbiology and Biotechnology

Abstract

Microbial interactions with metals may have several implications for the environment. The main resistance mechanisms for divalent heavy metals, such as Zn+ Cu+ and Ni2+ are active efflux transporters .This article explores the molecular basis of zinc resistance in the bacteria by determining the presence of znt-related genes and comparing the sequences obtained from these isolates with those published in the literature. It also investigates the adaptation of Bacillus cereus and expression of these znt genes. Heavy metal resistant genes were identified in Bacillus cereus, Pseudomonas aeruginosa and Enterobacter asburiae. CZC genes were observed in Pseudomonas aeruginosa and Enterobacter asburiae. Zinc transporting ATPase genes were observed in Bacillus cereus.

Keywords

Pseudomonas aeruginosa; Enterobacter asburiae; Bacillus cereus

Introduction

Microbes may play a large role in the biogeochemical cycling of toxic heavy metals also in cleaning up or remediating metalcontaminated environments [1]. The term ‘heavy metals’ refers to metallic elements that have high atomic weights (>100) and a relative density >5. Some heavy metals, such as cobalt, copper and zinc, are essential micronutrients for biological systems, although they may be toxic in larger amounts. Other metals, such as mercury, cadmium and lead, are biologically non-essential and toxic in any quantity [2]. According to the Agency for Toxic Substances and Disease Registry (ATSDR, 2013), arsenic, lead and mercury comprise the top 3 in the list of top 20 hazardous substances, while cadmium is ranked 7th. Major sources of heavy metal contamination in the environment are the combustion of fossil fuels, the operation of smelters and other industrial activities such as mineral mining and processing, brewery and distillery wastes and the generation and use of agricultural chemicals [2]. Heavy metals do not degrade in soil and many are considered persistent bioaccumulative toxins (PBTs).

The risk to human and ecosystem health from land-application of PBTs in residuals depends on solubility and bioavailability of these contaminants in the residual-treated soil. Uncertainties exist in the effect of decomposition of soil organic matter complexes that bind metal and uncertainties of the effect of slower long-term reactions between metals adsorbed to inorganic oxide surfaces in soil on metal solubility and bioavailability. Recent research findings show heavy metal is sorbed to oxide phases of biosolids [3]. Heavy metals sequestered to oxide surfaces will likely remain sequestered longer than metal complexed by biosolids natural organic matter. However, the stability of metal sequestered by oxide depends on the metal and the mineral oxide surface. Long-term mineral crystallization reactions may “eject” metals from the solid phase into solution.

Materials and Methods

PCR Analysis of the Presence of Zinc Resistance Genes based on the zntA Gene of Escherichia coli

To test for the presence of a typical Zinc-transporting ATPase/ cation-transporting ATPase, P-type, primers were designed. The zntA gene of Escherichia coli encodes a Zn(II)-translocating P-type ATPase were also used in the design of some primers [4]. Primer pairs were specifically designed to amplify overlapping fragments based on these zinc resistant genes for full sequence coverage of any amplified sections. The size and numbers of PCR fragments produced using the various primer pairs provided a preliminary estimation of which genes may be present or absent Table 1.

94°C                 94°C 40-50°C 72°C 72°C 4°C
5 min 30 sec 30 sec 1.30 min 5 min ∞
                                10+35 Cycles  

Table 1: PCR cycle conditions.

PCR mix components: Sample gDNA: ~50 ng; Forward Primer: 400 ng; Reverse Primer: 400 ng; Reverse Primer: 400 ng; 10 mM dNTPs mix: 4 μl; 10 X AMTaq Pol. Buffer: 10 μl; AMTaq Polymerase enzyme: 3 U; PCR grade water: to make the volume up to 100 μl.

Identification of Heavy Metal Resistant Genes in Pseudomonas aeruginosa and Enterobacter asburiae

The gene expression of heavy metal resistant genes in Pseudomonas and Enterobacter species was studied. RNA Isolation by TRIZOL Method [5] . 1 ml of TRI Reagent was added per 10 cm2 of glass culture plate to lyse the cells directly. The lysate was gently mixed by pipetting several times until a homogenous suspension was formed. The samples were transferred to a new 2 ml eppendorf tube and allowed to stand at room temperature for 5 minutes. 200 μl of chloroform was then added for each ml of TRI reagent used for lysis. The microfuge tube was vortexed vigorously for few seconds and allowed to stand for 12-15 min at room temperature for phase separation. The samples were centrifuged at 12000 xg for 15 minutes at 2-80°C. Centrifugation separated the mixture into 3 phases: a red organic phase (containing protein), an interphase (containing DNA), and a colorless upper aqueous phase (containing RNA). The upper aqueous phase was transferred into a fresh 1.5 ml eppendorf tube and 0.5 ml of isopropanol per ml of TRI reagent was added to it, followed by gentle pipetting. The samples were allowed to stand for 5-10 minutes at room temperature and centrifuged at 12,000 xg for 10 minutes at 40°C. The supernatant was carefully aspirated off the tube, leaving behind the precipitated RNA pellets on the sides of the tube. The RNA pellet was washed by adding a minimum of 1 ml of 75% ethanol per 1 ml of TRA reagent. The sample was then vortexed and then centrifuged at 7500 xg for 5 minutes at 2-80°C. Note: Samples can be stored in ethanol at 2-80°C at upto 1 year at -200°C. The RNA pellet was air-dried and re-suspended in 20-30 μl of RNase free water. Preparation of RNA - (No DNA Contamination)

Added to an RNase-free tube

RNA: 1 μg; 10 X reaction buffer with MgCl2: 1 μl; DNase 1, RNase-free: 1 μl; DEPC-treated water (#R0601): 10 μl

The tubes were incubated at 370°C for 30 minutes. 1 μl of 50 mmol EDTA was added and incubated at 650 for 10 minutes. It was then preceded to cDNA conversion Tables 2 and 3 and Figure 1.

10X RT Buffer, 1 ml 1 tube
10X RT Random Primers 1 tube
25X dNTP mix(100 mM) 1 tube, 0.2ml
Multiscribe TM Reverse Transcriptase, 50 U/µl 2 tubes, 0.1ml
RNase inhibitor, 100 µl 2 tubes

Table 2: Bacillus cereus- Genes for Metal Resistance.

# ID Sequence, 5'  to 3' Oligo Type Scale Purification # bases
1 CzcR - FP gtcatcacccggacgcagatcat DNA 25nmole Desalt 23
2 CzcR - RP gtagccgacgccgcgaatggtat DNA 25nmole Desalt 23
3 pcoA gene FP ACYTACTGGTAYCACAGCCATTC DNA 25nmole Desalt 23
4 pcoA gene RP CCACATVCCRTGCAGGTG DNA 25nmole Desalt 18
5 nccA gene FP ACGCCGGACATCACGAACAAG DNA 25nmole Desalt 21
6 nccA gene RP CCAGCGCACCGAGACTCATCA DNA 25nmole Desalt 21
7 β-Actin gene FP GTGGGCCGCTCTAGGCACCAA DNA 25nmole Desalt 21
8 β-Actin gene RP CTCTTTGATGTCACGCACGATTTC DNA 25nmole Desalt 24
9 CopA1 TCCATACACTGGCACGGCAT DNA 25nmole Desalt 20
10 CopA2 TGGATCGGGTGAGTCATCAT DNA 25nmole Desalt 20
          Total 214

Table 3: Details of Primers used in Pseudomonas aeruginosa and Enterobacter asburiae.

microbiology-biotechnology-Primer-details

Figure 1: Primer details of genes present in Enterobacter asburiae

Gene-1: (Zinc-transporting ATPase/cation-transporting ATPase, P-type) Primers Used

Forward Primer: ATGGCTGAAGCGTTAGTGAAAAAGAAACT

Internal Primer: GTCGGTGGAGATATCGTTTGGAGA

Reverse Primer: CTTATAAATCTTTCACTCGTAATACACGCAT

Gene-2: (Zinc uptake P-type ATPase) Primers Used:

Forward Primer: ATGAACTCAGAAGTAAAAACGTTACACGCA

Reverse Primer: CGTTATTTGCTTCCTTTTAGTAATCGTAAGC

Results and Discussions

Identification of (Zinc-transporting ATPase/cation-transporting ATPase, P-type and Gene-2: (Zinc uptake P-type ATPase) in Bacillus cereus

Chromatogram results of genes identified in supplementary 1. Real-time PCR was performed on an ABI 7900 Fast HT Sequence Detector (Applied Bio systems, Foster City, Calif.) (Figures 2a and 2b). Q-PCR mixtures contained SYBR green master mix. Annealing temperatures, primer concentrations, and MgCl2 concentrations were optimized. Fluorescence measurements were taken during the final temperature ramp. RT PCR amplification is done using these specific primers to study the gene expression as Delta CT Values. The genes CZC, PCOA, COP & NCC with endogenous control B actin. An endogenous control gene is a gene whose expression level should not differ between the samples, such as a housekeeping or maintenance gene. Comparison of the CT value of a target gene with that of the endogenous control gene allows the gene expression level of the target gene (CZC, PCOA, COP & NCC) to be normalized to the amount of input RNA or cDNA. The CZC gene expression is up regulated (Figures 3 and 4) in both these bacteria, which are indicated by the CT values, while in case of other genes it is not expressed (down regulated).

microbiology-biotechnology-metal-resistance

Figure 2: Bacillus cereus- Genes for metal resistance.

microbiology-biotechnology-Represents-amplification

Figure 3: Represents the amplification plot for all the genes studied in Pseudomonas aeruginosa and Enterobacter asburiae

microbiology-biotechnology-amplification-CZC

Figure 4: Represents the amplification of CZC gene in Pseudomonas aeruginosa and Enterobacter asburiae.

CT<29 are strong positive reactions indicative of abundant target nucleic acid in the sample

CT of 30-37 is positive reactions indicative of moderate amounts of target nucleic acid.

CT of 38-40 are weak reactions indicative of minimal amounts of target nucleic acid which could represent an infection state or environmental contamination genes related to heavy metal tolerance within the genome of isolated strain.

Discussion

Zinc Resistant Genes in Bacillus cereus

The genes screened included zinc-transporting ATPase gene, zinc uptake P-type ATPase gene in Bacillus cereus and CZC genes in Pseudomonas aeruginosa and Enterobacter asburiae. The integral membrane P-type ATPases are an important class of ion transport proteins that serve to maintain suitable ionic conditions. The term “P-type” refers to the formation of a phosphoenzyme intermediate in the reaction cycle. The energy released by the removal of the gama-phosphate from ATP is coupled to the translocation of an ion across biological membranes. Substrates are inorganic cations such as H+, Na+, K+, Mg2+, Ca2+, Cu+, Ag+, Zn2+, Cd2+, Co2+ and Pb2+. P-type ATPase-based resistance to zinc has been reported in E. coli and in P. putida strain S4 [5]. The ZntA P-type ATPase of E. coli has been predicted to be the first example of a zinc-specific transporter, based upon the close sequence homology of this ATPase to the CadA ATPase of Staphylococcus aureus and Helicobacter pylori enzymes, which affect the cellular zinc content. P-type ATPases mediating cadmium resistance also bring about zinc effux in most cases, while the P-type ATPases transport zinc only across the cytoplasmic membrane [6]. P-type ATPases constitute a superfamily of transport proteins that transport ions against the concentration gradient using energy provided by ATP hydrolysis.

Gene Expression of Heavy Metal Resistant Genes in Pseudomonas and Enterobacter Species

Analysis of changes in gene expression is an important part of fundamental and applied research. Northern blot, slot/dot blot, DNA arrays, and reverse transcription (RT)- PCR analyses are established techniques to estimate gene-expression rates, e.g., under different growth conditions. The genes CZC, PCOA, COP & NCC with endogenous control B actin were studied in Pseudomonas aeruginosa and Enterobacter asburiae. Presence of CZC genes were expressed in Pseudomonas aeruginosa. The three structural genes czcCBA are transcribed as a tricistronic mRNA of 6200 nucleotides [7]. These three genes are encoded in the structural gene region located in the center of the czc determinant. Two regulatory regions flank the structural genes, the upstream regulatory region, and the downstream regulatory region. Nine czc genes are transcribed in the same direction. This has also revealed that the CZC determinant was not species specific and is widely spread among bacteria isolated from entirely distinct geographical location. The best studied zinc resistance mechanism is the Czc system operating in Ralstonia, a Gramnegative soil bacterium. The Czc system conferring resistance to cadmium, zinc and cobalt in R. eutrophus strain CH34, functions as cation/proton antiporter effluxing cations from the cells [8,9]. The czc determinant encodes resistance to Cd2+, Zn2+ and Co2+ by metal-dependent efflux [10] driven by the proton motive force [11].

References