e-ISSN: 2321-6190 p-ISSN: 2347-2294

Yakışıklı erkek tatil için bir beldeye gidiyor burada kendisine türk Porno güzel bir seksi kadın ayarlıyor Onunla beraber otel odasına gidiyorlar Otel odasına rokettube giren kadın ilk önce erkekle sohbet ederek işi yavaş halletmeye çalışıyor sex hikayeleri Kocası fabrikatör olan sarışın Rus hatun şehirden biraz uzak olan bir türk porno kasabaya son derece lüks bir villa yaptırıp yerleşiyor Kocasını işe gönderip mobil porno istediği erkeği eve atan Rus hatun son olarak fotoğraf çekimi yapmak üzere türk porno evine gelen genç adamı bahçede azdırıyor Güzel hatun zengin bir iş adamının porno indir dostu olmayı kabul ediyor Adamın kendisine aldığı yazlık evde sikiş kalmaya başlayan hatun bir süre sonra kendi erkek arkadaşlarını bir bir çağırarak onlarla porno izle yapıyor Son olarak çağırdığı arkadaşını kapıda üzerinde beyaz gömleğin açık sikiş düğmelerinden fışkıran dik memeleri ile karşılayıp içeri girer girmez sikiş dudaklarına yapışarak sevişiyor Evin her köşesine yayılan inleme seslerinin eşliğinde yorgun düşerek orgazm oluyor

Genetic Characterization of Three Species of the Genus Cornudiscoides Kulkarni, 1969 (Monogenoidea: Dactylogyridae), Parasitizing Long Whiskered Cat Fish Sperata aor (Ham) Using Ribosomal and Mitochondrial DNA

Verma Jyoti*, Rajvanshi Saroj and Agrawal Nirupama

Department of Zoology, University of Lucknow, Lucknow, Uttar Pradesh, India

*Corresponding Author:
Verma Jyoti
Department of Zoology
University of Lucknow
Lucknow, Uttar Pradesh, India
Tel: +915222740230
E-mail: jyotiaug22@gmail.com

Received date: 15/04/2018; Accepted date: 06/06/2018; Published date: 08/06/2018

Visit for more related articles at Research & Reviews: Journal of Zoological Sciences

Abstract

Three congeneric species of the genus Cornudiscoides Kulkarni, 1969 (Monogenoidea: Dactylogyridae) viz. C. longicirrus, C. aori and C. mystusi, parasitizing gills of Sperata aor were examined. These morphologically valid species were subjected to molecular analysis, using partial 28S, 18S rDNA and Mitochondrial COI gene to characterize them genetically. 28S and 18S ribosomal markers are reliable and useful tools to trace the evolutionary linkage at generic/specific level. Comparative study of 28S and 18S showed close relation of these species with other Cornudiscoides sp. While, mt COI based structural proteomics (1D/2D/3D) confirms species differentiation. Apart from molecular characterization, current study strengthens earlier morphological validation of these three species of Cornudiscoides

Keywords

Cornudiscoides longicirrus, Cornudiscoides aori, Cornudiscoides mystusi, Sperata, 28S and 18S ribosomal subunits, Protein structures, Polymerase chain reaction, Phylogeny

Introduction

Genus Cornudiscoides Kulkarni, 1969 (Monogenoidea: Dactylogyridae) was considered as oioxenus (strictly host specific/ host specialist) monogenoid, parasitize only species of Mystus Scopoli. Transfer of some fish species of Mystus under the genus Sperata Holly, 1939 has changed status of the genus Cornudiscoides to metasteoxenous (sub-category) of category mesoxenous that parastize on gills of more than one genus of a family [1]. So far, sixteen nominal species of Cornudiscoides are reported in India [1] thirteen parasitizing on Mystus spp. and three on Sperata sp. (earlier under the genus Mystus). S. aor harbors three oioxenous congeneric species, C. mystusi Dubey et al. C. longicirrus Agrawal et al. and C. aori Agrawal et al. Sperata aor is commercially important freshwater cat fish [2] having significant food value [3,4]. The host harboring Cornudiscoides ranged from India, Nepal, Sri Lanka, Bangladesh, Myanmar Thailand, Indochina, Peninsular Malaysia, Singapore, Syria and East Indies to China [3] while the genus Cornudiscoides is reported only from India, Pakistan, Sri Lanka and Peninsular Malaysia [1,5].

In the present paper, we have used 28S and 18S ribosomal DNA to characterize the Cornudiscoides species and to evaluate relationship using phylogenetic analysis as ribosomal DNA is an effective molecular marker for molecular analysis due to availability of large number of copies and presence of highly conserved to variable regions [6,7]. Some pioneer workers have already reported importance of 28S ribosomal DNA in molecular taxonomy and systematic placement of helminthes parasites [8,9] while some reported, 18S ribosomal DNA is more instructive to explain relationship among them Mitochondrial COI based 1D, 2D and 3D (primary, secondary and tertiary) protein conformations have also been utilized herein for species differentiation. Beside these, we are attempting for genetic validation of Cornudiscoides multi-species complex parasitizing S. aor that substantiate morphological study.

Materials and Methods

Collection and Identification

Live fish were procured from river Gomati and local fish markets of Lucknow (26°8'N 80°9'E), Uttar Pradesh, India. Gills were placed in Petri dish with tap water and examined for monogenoideans under binocular. Parasites were placed in a drop of water on slide under the cover slip and identified using “An Encyclopedia of Indian Monogenoidea” by Pandey and Agrawal under Phase Contrast Microscope (Olympus BX-51, Tokyo, Japan). Measurements and drawings of sclerotized parts of query Cornudiscoides spp. (Tables 1-4) are taken from their original descriptions [1] and present study.

Gene Primer Name Sequence 5' to 3' Source
28S rDNA Forward primer (Ancy 55) GAGATTAGCCCATCACCGAAGG Plaisance et al.
Reverse primer (LSU 1200 R) GCATAGTTCACCATCTTTCGG
18S rDNA Forward primer (Worm A) ACGAATGGCTCATTAAATCAG Plaisance et al.
Reverse primer (Worm B) TTGCTGCACTCTTCATC
Mt COI Forward primer (Asmit1) TTTTTTGGGCATCCTGAGGTTTAT Chaabane et al.
Reverse primer (Asmit2) TAAAGAAAGAACATAATGAAAATG

Table 1: Details of gene, primers and their sources.

Monogenoideans Host Species Sequence Length (bp) GenBank No. COI
28S 18S COI 28S 18S  
C. longicirrus Sperata aor 993 1030 393 KY009858 KY01892 Submitted
C. aori Sperata aor 998 928 395 KY009859 KY018928 Submitted
C. mystusi Sperata aor 1000 1109 395 KY091690 KY091691 Submitted
C. proximus M. vittatus 362 600 - GQ925913.1 KU235550  
Thaparocleidus susanae - 324 - - - KC962228.1 -
T. aori - 328 - - - KC962227.1 -
Euryhaliotrematoides sp.1 - - 1752 - - EU836217.1 -
Euryhaliotrema sp. 3 - - 1645 - - EU836215.1 -

Table 2: List of parasite (obtained/retrieved from GenBank), their hosts, base pair length and their accession number.

Characters C. longicirrus C. aori C. mystusi
Agrawal et al. (μm) Agrawal et al. (μm) Present Study (μm)
Body
Length 329-765 387-568 314-475
Width 112-147 82-110 60-74
Pharynx
Diameter 30-45 23-29 25-30
Haptor
Length 132-140 59-112 58-60
Width 94-99 89-105 55-65
Dorsal Anchor
Total length - - -
Inner length 44-48 36-38 34-38
Outer length 34-40 28-33 29-35
Recurve Point 23-28 32-26 21-24
Patch 20-24 12-15 11-14
Ventral Anchor
Total length - - -
Inner length 27-30 21-24 21-24
Outer length 22-25 12-19 22-25
Recurve Point 14-16 13-15 20-24
Dorsal bar 29-42  28-33 30-34
Ventral bar 68-114 76-112 31-34
Ovary
Length 71-96 45-72 50-56
Width 55-70 30-46 55-60
Testes
Length 79-96 51-61 71-74
Width 52-62 34-46 73-76
Hooks
Large hooks 24-28 17-22 24-26
Small hooks 12-14 11-12 13-14
Copulatory complex
Copulatory tube 71-96 48-45 86-89
Accessory piece 32-40 21-24 28-30
Vagina
Length 31-42 31-42 40-50

Table 3: Measurements of three species of Cornudiscoides, parasitizing Sperta aor.

Characteristics Cornudiscoides longicirrus Cornudiscoides aori Cornudiscoides mystusi
Dorsal anchor equation equation equation
Ventral anchor equation equation equation
Dorsal bar equation equation equation
Ventral bar equation equation equation
Large hook equation equation equation
Small hook equation equation equation
Copulatory complex equation equation equation
Vaginal armature equation equation equation

Table 4: Hard parts of C. longicirrus, C. aori and C. mystusi, as drawn in original description.

Parasites were stored in absolute alcohol for molecular analyses. Genomic DNA was extracted using DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) as per manufacturer’s protocol. Partial 28S rDNA, 18S rDNA and Mt COI regions were amplified using primers mentioned in Table 1. The polymerase chain reaction (PCR) amplifications were performed in a final volume of 12.5 μl, containing 10× buffer (100 mM Tris, pH 9.0), 50 mM KCl, 15 mM MgCl2, 2.5 U Taq polymerase enzyme, 10 mM of each deoxynucleotide triphosphate (dNTP’s) and 3 μl DNA. For 28S and 18S, following thermo cycling profile was utilized: denaturation of DNA (94°C for 3 min.); 35 cycles of amplification (94°C for 30s, 52°C for 30s and 72°C for 2 min); 10 min extension and hold at 72°C. For COI, denaturation of DNA (95°C for 5 min.); 35 cycle of amplification (94°C for 1 min. 50°C for 1 min. and 72°C for 1 min.); 6 min extension and hold at 72°C. PCR products were visualized on 2% Agarose gel in TAE (Tris–acetic acid–EDTA) buffer, stained with Ethidium Bromide (EtBr) under ultraviolet (UV) light. The purified PCR products were used for sequencing. Sequencing was done by Amnion Biosciences, Bangalore using an automated sequencer (Model Name 3130×1/3130x/GA-1203-019). The obtained nucleotide sequences (partial 28S and 18S rDNA) of Cornudiscoides spp. were used for phylogenetic analysis along with published sequences, retrieved from GenBank (Table 2).

Sequence Analysis

Blastn was performed to search sequence similarity of newly obtained sequences of partial 28S and 18S rDNA regions. Number of nucleotide (ATGC) was calculated through https://www.sciencebuddies.org. A phylogenetic analysis was performed using MEGA 6.06 [10] and trees were generated through Neighbor-joining NJ and Minimum Evolution (ME) methods at 1000 bootstrap value. Translation of nucleotide sequences of COI gene was done by Emboss transeq tool version 6.6.0 of Expasy [11,12]. All asterisks were omitted from primary protein dataset (1D/amino acid string) of C. longicirrus, C. aori and C. mystusi. ExPASy Prot- Param was used to predict statistical values of amino acid (Table 5) sequence [13]. 3D conformation of 1D data set was generated by Threading method (sequence that have query coverage below 80%) using HMM-HMM (Hidden Markov Model) that facilitate searching of homologous template for target protein [14]. The target-template complexes were predicted by Chimera 1.10.1 [15,16]. Target and template protein conformations were annotated with different colors (C. aori, C. longicirrus and C. mystusi were coded with red, green and magenta while template was cyan blue for all species). Root mean square values (RMSD) were calculated to estimate sequence divergence between target and template protein sequence [15,16].

S. No. Parasite Name (Target) Number of Amino Acids Molecular Weight Positively/Negatively Charged Amino Acid Best hit Template Query/Confidence
Coverage/Percent Identity
RMSD value
1 C. aori 126 14848.31 9/4 d12asa 34%/16.4%/42%/0.000Å
2 C. longicirrus 120 14055.50 14/6 c2e5zA 17%/21.7%/30%/0.000Å
3 C. mystusi 125 15148.36 5/9 d1scfc 22%/24.4%/30%/0.000Å

Table 5: Characteristic features of protein data set with template.

Results

Molecular Study

The amplicon length of different molecular markers for C. longicirrus, C. aori and C. mystusi were 993, 988 and 1000 base pairs for large ribosomal subunit; 1030, 928 and 1109 base pairs for small ribosomal subunit and 393, 395 and 419 for COI. Blastn search for large subunit and small subunit of ribosomal DNA of these three species reveals highest sequence similarity with C. proximus. The estimated G+C contents value of C. longicirrus, C. aori and C. mystusi was 45.9%, 45.3%, 46.7% for 28S rDNA; 46.9% 48.4% 46.7% for 18S rDNA and 34%, 31.3% and 32.6% for mt DNA respectively. Small ribosomal subunit has more variability in nucleotide composition than large subunit as it is less conserved in comparison to 28S rDNA region. Clustal Omega based alignment showed, 985 base pair (bp) alignment sites for 28S rDNA region, of which 137 sites are substitution (128 parsimony informative sites and 9 parsimony-uninformative sites) and 7 sites are insertions/deletions. 18S rDNA region showed 886 bp alignment sites having 76 substitutions (74 parsimony informative sites, 2 parsimony-uninformative) and 19 insertions/ deletions.

Phylogenetic Analysis

Six newly obtained and other retrieved sequences (GenBank) were used to reconstruct the phylogenetic trees (NJ and ME methods) for two different regions (partial 28S and 18S rDNA) to evaluate genetic relativeness of these three species (present study) with other Cornudiscoides species (Figures 1 and 2). All phylogenetic trees depicted well-supported bootstrap values and similar evolutionary pattern for query species used in study (Figures 1 and 2). The Cornudiscoides species of Sperata aor clustered together, forming a sister group with C. proximus (parasite of Mystus species) and a separate clade with Thaparocleidus sp. (Figure 1) and Euryhaliotrematoides sp. (Figure 2). Where Thaparocleidus and Euryhaliotrematoides are treated as out-group. In 28S phylogenetic tree C. aori and C. longicirrus are more closely related than C. mystusi, forming a subgroup with C. proximus. However, 18S region based tree showed close liaison between C. aori and C. mystusi than C. longicirrus.

zoological-sciences-topology

Figure 1: Tree topology found with partial 28S rDNA data using NJ/ME/UPGMA methods with bootstrap values for NJ and ME method (shown above and below branches)./p>

zoological-sciences-bootstrap

Figure 2: Tree topology found with partial 18S rDNA data using NJ/ME/UPGMA methods with bootstrap values for NJ and ME method (shown above and below branches).

3D Conformation of Protein of Cornudisoides spp.

Each query species comprises unique amino acid composition (primary data set) suggesting species variation at primary level (Table 5). However, main characteristic features of 2D conformation (disordered, a-helix, Beta-strand and TM helix) are also peculiar for all three query species. C. aori has 7%, 41%, 31% and 13%, disordered, a-helix, Beta-strand and TM helix which is 8%, 98%, 0% and 65% for C. mystusi. Howbeit, 2D conformation of C. longicirrus has only disordered (16%), alpha helix (45%) and beta strand (18%). Tertiary structures of all three Cornudiscoides spp. are also different from each other (Figure 3A-3C) evincing species differentiation. Nevertheless, species dissimilarity, the superimposed target-template complexes, predicted by structural alignment of target and template protein suggests structural identity/similarity between both protein sequences. Identical sequences of target protein get annotated with same colour as that of template. Similar/non-match sequences remain in their original colour (Figure 3D and 3F). C. aori, C. longicirrus and C. mystusi, all three have 0.00 Å RMSD value with template respectively (Table 5). While structural superimposition of all three Cornudiscoides spp. have 0.633 Å RMSD value insinuating sequence divergence among these three species. 3D proteomic structure based genomic linkage showed more or less similar conformation for C. longicirrus and C. mystusi while C. aori conforms into a different structure. These structural resemblances are also visible in sclerotized parts of Cornudiscoides species (Table 4). C. longicirrus and C. mystusi have almost same morphological features (reproductive parts long with coil/twist) rather than C. aori (short, simple). Ramachandran plot values exhibiting, 87.2% amino acid in favoured region, 5.1% in allowed and 7.7% in outlier region for C. aori, which is 100%, 0.0%, 0.0% and 94.4%, 5.6%, 0.0% for C. mystusi and C. longicirrus respectively. These values indicating that C. mystusi and C. longicirrus have stable and good conformation while C. aori has stable and average hypothetical protein structure.

zoological-sciences-target-template

Figure 3: (A) 3D conformation of C. aori (B) C. longicirrus (C) C. mystusi (D) target-template complex of C. aori (E) C. longicirrus (F) C. mystusi.

Discussion

Agrawal et al. morphologically validated three monogenoidean species collected from Sperata namely C. longcirrus, C. aori and C. mystusi, based on morphology of reproductive parts (key characters of species differentiation). Earlier parasitological documents have already demonstrated that reproductive parts of monogenoid provide species level identification [17] while haptoral parts are of generic importance. Here, molecular tools have been employed to complement morphology based species identification, genetic characterization and systematic placement of these three species of Cornudiscoides. The PCR-based DNA sequencing proves worthy for species identification of closely related congeneric parasites [18]. The ribosomal DNA of monogenoids is still being used expeditiously to evaluate phylogenetic relationship at family and subfamiy level [19-21]. Ribosomal DNA based analysis is truly useful for evidencing intra and inter-specific variations among Cornudiscoides species as it evolves with varying rates from highly conserved (18S, 5.8S and 28S) to variable (transcribed and non-transcribed or IGS) regions [22] and provide easy alignment for taxa [23] that is useful for genetic characterization of species. Present work evidences, comparative study of 28S and 18S regions of ribosomal DNA reveals considerable sequence similarity at genetic level and difference at specific level.

The Phylograms for 28S and 18S ribosomal DNA region depicted same topology and display clear-cut relationship among them. The evolutionary linkage of Cornudiscoides species suggests, evolution of Cornudiscoides spp. parasitizing Mystus is prior to those infesting Sperata as it was already shown in earlier documents [24]. Lakra et al. and it reveals co-speciation of host and parasite. If parasite demonstrates phenomenon of host switching, phylogenetic congruence between parasite-host will be imperfect and parasite based host speciation cannot be traced [25-31].

COI based protein conformations are efficient to unwind the complexity among the parasite community. The mitochondrial genome database has made it accessible across the world that facilitates global identification system and no doubt compensate with all deficits of morphology based species differentiation. The intra/interspecific biodiversity will be easily predictable using mitochondrial region, specifically for genome modifications under geographical changes, sibling species, hybridized forms, erroneous placements, misidentification and validation of taxonomic establishments. Thus, sequence based genetic identification system brings basic and modern biology together to substantiate taxonomic research which is a ground of all modern science and technology. Here, involvement of translated mitochondrial DNA sequence based biological identification is used that offers outstanding ways to identify and distinguish closely related species of multi-species complex as Cornudiscoides (validated by Agrawal et al.). The protein coding regions of mt COI gene chiefly affects morphological features of species [18]. These morphological differentiations are species specific. The proteomic Insilco studies are seemingly valuable for intra/inter specific differentiation and validation of species among parasitic community. Thus, computer based study of mitochondrial sequences showing expeditious ways to predict genetic variations at varying level. Primary information (1D dataset/amino acid sequence) suggests genetic variability among these three Cornudiscoides sp. These variations express into completely different 2D/3D protein conformations. The obtained results of 1D/2D/3D conformations assisting genetic validation of three query species of multi-species complex. The 3D protein conformations of all species have completely different set of characters, explaining species variation and offering instant view to differentiate congeneric species. The information rich data based structural proteomics of query species suggests 100% correct identification and differentiation. Our observations support earlier placement of these three query species under Cornudiscoides as they are genetically allied to each other which is also reflected by sclerotized parts of monogenoids.

Conclusion

Molecular biology seemingly corroborates morphological identification of three query species as C. longicirrus, C. aori and C. mystusi (consanguineous of other Cornudiscoides spp.) and suggesting genetic distinction. The use of COI additionally strengthens genetic linkage and differentiation of query species. We are at the opinion, the value and robustness of any classification scheme, lower to higher taxonomic categories; rely upon basic concept of species identification.

Acknowledgements

This work was financially supported by University Grant Commission, India to Jyoti Verma [F25-1/2013-14 (BSR)/7- 109/2007] and Nirupama Agrawal [F-410/2010] and [F.6-6/2017-18/Emeritus-2017-18-Gen-9293/ (SA-II)].

References