An Improved Sample Preparation Method for the Detection of Plasmodium falciparum in Blood Samples | Open Access Journals

ISSN: 2322-0066

An Improved Sample Preparation Method for the Detection of Plasmodium falciparum in Blood Samples

Thavamani Rajapandi*

Department of Natural Sciences, Coppin State University, Baltimore, Maryland

*Corresponding Author:
Thavamani Rajapandi
Associate Professor of Biology
Department of Natural Sciences
Coppin State University
Science and Technology Center 204
2500 West North Avenue, Baltimore
Maryland 21216
Tel: 410- 951-4260
E-mail: trajapandi@coppin.edu

Received Date: 21/03/2018; Accepted Date: 12/04/2018; Published Date: 20/04/2018

Visit for more related articles at Research & Reviews: Research Journal of Biology

Abstract

Microscopy remains the gold standard for the detection of malaria parasites in blood samples, while rapid diagnostic tests (RDTs) and polymerase chain reaction (PCR)-based methods are increasingly employed for field applications, each with limitations. Using in vitro cultured Plasmodium falciparum parasite isolates, we analyzed several sample preparation methods for PCR-based detection. Test samples subjected to hypotonic lysis, followed by a near complete depletion of hemozoin (Hz) and hemoglobin (Hb) and subsequent PCR amplification of the msp2 gene resulted in a detection limit that was improved over samples prepared in isotonic buffer conditions. In addition, we amplified sequences of several target genes, including the msp2-, msp1-, 18S rRNA- and eba175 from parasite extracts prepared by hypotonic lysis. We identified a primer set which amplified a region within eba175 that gave a greater detection limit of 1 parasite per 5 × 107 red blood cells (RBCs), as well as a primer set for msp2 that gave a detection limit of 1 to 5 parasites per 5 × 107 RBCs by standard PCR analysis. The remaining targets exhibited maximum detection limits of 20 to 30 parasites per 5 × 107 RBCs. This newly developed method is 100 to 500 times more sensitive than currently available PCR-based methods which detect 30 to 100 parasites per 5 × 106 RBCs in 1 μl of blood). In addition, this method could be used in field deployable PCR-based diagnostics, as well as for parasite genotyping and quality control of failed RDTs.

Keywords

Plasmodium falciparum, Polymerase chain reaction, Rapid diagnostic tests, Hemozoin, Parasitemia

Introduction

Detection of Plasmodium infections among pre-symptomatic and asymptomatic individuals plays a key role in the control of malaria transmission, treatment and the proper use of anti-malarial drugs. Microscopic observation, antigen detection by Rapid Diagnostic Tests (RDT) and Enzyme-linked immunosorbent assays (ELISA), and nucleic acid-based techniques are commonly used for diagnostic purposes. Microscopic observation of Giemsa-stained blood smears is the most commonly accepted practice for the diagnosis of malaria [1]. Another diagnostic method is RDT, based on the colorimetric detection of malaria parasite specific antigens. Currently, all field deployed RDTs detect P. falciparum specific histidine rich protein 2 (PfHRP-2), lactate dehydrogenase (PfLDH), or aldolase [2-4]. However, malaria parasite detection by RDTs requires large numbers of parasites in blood samples. The maximum detection limit by RDT is 100 parasites per μl of blood for all Plasmodium species [(0.001% infection in 5 × 106 RBC per μl of blood) [1]. Therefore, it is generally accepted that RDT is not optimal for the detection and diagnosis of malaria in blood samples with limited numbers of live parasites. Additionally, false positives may result due to the presence of parasite antigens in spite of parasite clearance following chemotherapy. Moreover, the detection limit of currently available PCR-based methods requires a minimum of 30 to 100 parasites in 1 μl of blood sample or 5 × 106 RBCs collected from in vitro cultured parasites [5]. These limitations highlight the need for a more sensitive and field-adaptable method for better diagnosis of clinical samples usually with low parasitemia. Yet, another consideration is the sample preparation method and selection of the best suitable target(s) for nucleic acid-based detection. These two parameters have not been extensively studied for field samples or samples prepared from in vitro cultured parasites. We were interested in improving the sample preparation method and PCR-based diagnosis by determining the optimal gene target for a successful detection of a very low number of plasmodium parasites in the clinical samples as well as RDT-failed samples as a quality control measure.

Methods

Plasmodium falciparum in vitro culture and sample preparation for PCR by hypotonic lysis of RBCs and iRBCs (parasite infected RBC): P. falciparum cultures were maintained in RPMI containing 10% pooled heat-inactivated human serum as described previously [6]. 10 μl of packed RBCs (5 × 107 RBCs) harboring a non-detectable level of parasites by light microscopy (5-10 parasites/sample) was diluted in 0.5 × 108 uninfected RBCs (100 μl of 50% blood). The RBCs were collected by centrifugation and resuspended in 0.5 ml of isotonic (1X PBS) or hypotonic (0.1X PBS) buffers and mixed well by vortexing. The samples were incubated on ice for 5 min and the parasite pellet was collected by centrifugation. The parasite pellet was extensively washed with 5 ml of respective buffers. The supernatant was carefully removed without disturbing the pellet and the pellet was resuspended in 100 μl of water and heated at 95°C for 5 min. The various target genes from 10 μl of samples (equivalent to 5 × 106 RBCs) were amplified by PCR in 50 μl reaction mixes. Ten μl (1 × 106 RBC equivalents) of the samples were analyzed by SYBR® Green I detection following agarose gel electrophoresis.

PCR Amplification

Platinum Taq polymerase used in the PCR reaction was obtained from Thermo Fisher Scientific (cat # 10966026), and the PCR was performed with the primer sets listed in Table 1. In a typical PCR reaction, a master mix was prepared by adding MgSO4, dNTP mix, 1X PCR buffer and nuclease free water as described previously [5]. The required volume of the diluted buffer mix was aliquotted into multiple tubes containing the primer mixes and the template DNA. PCR reactions were performed by the PTC-200 (MJ Research Inc., USA) thermocycler under the conditions listed in Table 1 for various target genes. Ten to 20 μl of the PCR amplified products were analyzed in a 0.85% SYBR® Green I-stained agarose gel and photographed by using a Gel Doc XR gel documentation system (Bio-Rad, cat # 1708195).

Table 1. Primers (sequence provided in the table) used for the amplification of the target genes, amplicon sizes and the conditions used for PCR amplification.

Gene target Primer sequence 5’-3’  PCR condition Amplicon size (bp)
msp2 F: ATGAAGGTAATTAAAACATTGTCT
R: TTATATGAATATGGCAAAAGATAAAAC
1. 95°C for 5 min;2.Annealing at 58°C for 2 min
3.Extension at 72°C for 2 min
4.Denaturation at 94°C for 1 min.
repeat steps 2-4 30 times.
819
eba175 F: GAGGAAAACACTGAAATAGCACAC
R: CAATTCCTCCAGACTGTTGAACAT
1. 95°C for 5 min;
2. Annealing at 58°C for 2 min
3.Extension at 72°C for 2 min
4. Denaturation at 94°C for 1 min.
repeat steps 2-4 30 times.
795
ssurna F: TTAAACTGGTTTGGGAAAACCAAATATATT
R: ACACAATGAACTCAATCATGACTACCCGTC
  1. 95°C for 5 min;
2. Annealing at 58°C for 2 min
3.Extension at 72°C for 2 min
4.Denaturation at 94°C for 1 min.
repeat steps 2-4 30 times.
1200

Results

P. falciparum detection by PCR using samples prepared by hypotonic lysis of iRBCs: Several methods have been widely used for the diagnosis of malaria such as microscopic evaluation of Giemsa-stained blood smears, RDTs and PCR-based amplification of parasite-specific DNA sequences. All these methods utilize heat-inactivated samples that include cytoplasmic contents prepared from whole blood or lysates prepared from parasite-infected RBCs devoid of WBCs. In this study, we devised an improved sample preparation method from parasite-infected blood in the presence or absence of WBCs. Simply, the perturbance of the osmotic balance either shrinks the red blood cells or results in lysis. Under hypotonic condition (either water or 15 mM Phosphate buffer at pH 7.0), RBCs burst and release all the cytoplasmic contents including hemoglobin. In this procedure, the released cytoplasmic contents were removed by centrifugation and the genomic materials were pelleted down along with membranes. This crude pellet was heated to inactivate potential nucleases and the heated samples were used directly for the PCR-based amplification of parasite-specific target sequences. The test samples were prepared by various methods as indicated in Figure 1 and representative samples are shown here. As shown in Figure 1, hypotonic lysis of samples in 0.1X PBS (15 mM phosphate buffer pH 7.0), followed by complete removal of released hemoglobin and most of hemozoin by repeated washing of the pellet in 0.1x phosphate buffer, resulted in greater sensitivity of detection of P. falciparum by PCR. Isotonic lysis of parasites in 1X PBS or hypotonic lysis without the removal of cytoplasmic contents did not increase the sensitivity compared to the hypotonic lysis combined with the removal of cytoplasmic contents (compare panels 1-12, 1’-12’ and 1”-12” in Figure 1). The sensitivity of PCR amplification was determined based on the percentage of PCR positive samples obtained from the total number of samples tested. The results showed that 100% of samples were positive with the hypotonic lysis method while 20% of samples were positive with hypotonic lysis method without the removal of released cytoplasmic contents. Treatment of samples with the isotonic buffer method did not yield positive results by PCR.

biology-detection

Figure 1: P. falciparum detection by PCR using samples prepared by hypotonic lysis of iRBC: The msp2 gene was amplified by PCR- from multiple test samples as described in the Methods section. Samples were analyzed by agarose gel electrophoresis. Lanes 1-12, hypotonic-lysis of parasite-infected erythrocytes, and a near complete depletion of the trace amount of both hemozoin and hemoglobin by centrifugation (see Methods section); lanes 1’-12’, addition of parasite-infected blood suspended in 1XPBS into the PCR reaction mix; and lanes 1”-12”, addition of hypotonically-lyzed lysate with Hb and Hz.

Target selection for the sensitive detection of P. falciparum infection: Several targets have been analyzed and used for PCRbased detection and diagnostics of malaria, and the most commonly used targets are the small and large subunit 18S rRNA specific sequences. In order to select a sensitive target, we analyzed several oligonucleotide primer sets against multiple target genes, including msp2-, msp1-, ssu rRNA- and eba175 for PCR amplification. As a first step, we used purified genomic DNA (Figure 2) as the target material. As shown in Figure 2, we identified a primer set specific to F or C type eba175 sequence(s) that resulted in higher sensitivity of detection of P. falciparum DNA by PCR compared to primers specific for msp2 and ssrRNA. The eba175 primer set had the potential to detect genomic DNA equivalent to 0.5 parasites under standard PCR analysis. The next best target was msp2, with the potential to detect one parasite equivalent of genomic DNA. The remaining targets were limited to 20-30 parasite equivalents of genomic DNA (Figure 2, and data not shown).

biology-genomic

Figure 2: Target selection for the detection of P. falciparum infection: msp2, eba175 and ssu rRNA genes were amplified from various concentrations of purified P. falciparum genomic DNA. PCR was performed in a 50 μl reaction and 10 μl from the reaction mix was analyzed by agarose gel electrophoresis. Lane 1: 2 ng; lane 2: 0.2ng; lane 3: 0.02 ng, and lane 4: 0.002 ng.

Determination of P. falciparum detection sensitivity limit by PCR using samples prepared by hypotonic lysis: In order to determine the PCR-based detection limit of eba175 and msp2 primers in crude samples obtained by hypotonic lysis of parasites, P. falciparum-infected RBCs were serially diluted and eba175 and msp2 were amplified from the samples prepared by hypotonic lysis. These results indicated that the primer set specific to a 1 kb sequence within eba175 and msp2 provided the most sensitive targets for diagnostics purposes and is suitable for both purified genomic DNA as well as the crude samples obtained from parasite cultures either in the presence or absence of human genomic DNA (Figures 3A and 3B) [8-10].

biology-parasites

Figure 3: Determination of P. falciparum detection limit by PCR using samples prepared by hypotonic lysis. A, P. falciparuminfected erythrocytes were diluted from 4 × 104 to 0.04 parasites per reaction in culture medium or 1X PBS containing 1 × 109 uninfected erythrocytes. Samples were prepared by hypotonic lysis as described in the methods section. The eba175 (e) and msp2 (m) genes were amplified by PCR- in a 50 μl reaction mix and 20 μl of the samples were analyzed by agarose gel electrophoresis followed by SYBR® Green I staining. B, RBCs harboring 2.0% parasitemia in a 0.5 ml volume of blood (equivalent to 10 μl of packed cells) was diluted in 4.5 ml of whole blood containing human white blood cells (equivalent to 1 × 109 RBCs or 0.1 ml packed cells). This suspension was serially diluted up to 10-9 in 1 × 109 uninfected RBCs. One ml of serially diluted samples were processed as described in the Methods section and resuspended in 100 μl of water. The eba175 gene was amplified by PCR in a 50 μl reaction mix and 20 μl of the samples were analyzed by agarose gel electrophoresis followed by SYBR® Green I staining.

Discussion and Conclusion

In this study, a simple and improved sample preparation method using blood samples harboring a microscopically non-detectable level of Plasmodium parasites was developed. The test sample was prepared by hypotonic lysis of iRBCs and a near complete removal of hemozoin (Hz) and hemoglobin (Hb) by centrifugation. These two key steps enhanced the PCR-based detection limit of malaria parasites to several hundred-fold from blood samples with low parasitemia. This phenomenon may be explained by high contents of Hb or Hz which inhibited the rate of amplification of both eba175 and msp2 gene sequences (data not shown). This is supported by our results using samples prepared by hypotonic lysis and removal of Hb and Hz which improve the level of detection. Also, samples prepared in 1x phosphate buffer which contains ~ 155 mM sodium phosphate which provides an isotonic condition, which is equivalent to physiological osmotic condition and RBCs and iRBCs will not be lysed. The high concentration of hemoglobin and or hemozoin will potentially inhibit the polymerase activity in the PCR reaction. The hyponic lysis method released all the hemoglobin and most of the hemozoin are washed out, and in particular the potential inhibitors are removed in this sample preparation method. This crucial and simple step improved the sensitivity of detection of parasite DNA by PCR. Interestingly, PCRbased amplification of eba175 was affected in one of the test samples containing high number of parasites that was subjected to hypotonic lysis. The selection of targets such as eba175 and/or msp2 resulted in higher levels of detection by PCR compared to other commonly used targets in previously published studies (Table 2) [10-12]. It should be noted that interpreting PCR-based diagnostic results in clinical samples can be problematic, similar to antigen-based detection approaches. This may due to a small fraction of parasite DNA that remains in the bloodstream after the infection is cleared by anti-malarial drug therapy and the large excess amount of human genomic materials. Therefore, the differentiation of an active infection from a recently cleared infection is arguable. However, the quantity of parasite DNA from recently cleared parasites should be almost negligible when parasitemia is at a non-detection level. The sensitivity level obtained from the samples prepared by hypotonic lysis is several folds greater than previous published studies. Therefore, this newly developed method will help to solve many challenges in the diagnosis of malaria by microscopy, RDTs and PCR-based methods. In conclusion, adapting this simple method to a field setting by using a portable PCR machine is also amenable with greater accuracy.

Table 2. Currently available tools to detect malaria parasites and a comparison of the sample.

Method Target Detection Limit Parasite/µl blood sample Description of target and Limitation Reference
Microscopy Whole parasite 30 Detects asexual and sexual blood stage parasites of all species under microscope. Kobayashi T [7]
Reliable readings require skilled microscopists
RDT Antigen >100 Detects malaria antigen by immunochromatographic assay with monoclonal antibodies to target parasite antigen.Antibody requirement Kobayashi T [7]
Antibody requirement
PCR (conventional and real time) DNA 10 Amplifies target parasite DNA. Depending on the target gene, genus- and species-level diagnoses are available. The result of conventional PCR is qualitative, whereas qPCR
is quantitative.
Purified DNA is required
Kobayashi T [7]
RT-PCR RNA 10 Detects mRNA expressed at specific life cycle of the parasite. The test can be used to measure the transmissibility of the infection by quantifying the presence of mosquito-infective sexual stages. Kobayashi T [7]
 Purified RNA is required
NASBA RNA <1 parasite Amplifies target RNA in a single step isothermal condition. Purified RNA is required. Kobayashi T [7]
LAMP DNA 5-10 Detecting infection by a turbidity meter after amplifying parasite DNA. Kobayashi T [7]
DNA extraction methods are key
Serological tests Malaria parasite specific antibody >100 Detects and measures antibodies against malaria parasites as an indicator of recent and/or past exposure to parasites. Kobayashi T [7]
Antibody required
Hypotonic lysis of whole blood Whole blood <1 parasite/>100 µl whole blood eba75
and msp2
This study

References